Site Loader
Rock Street, San Francisco

Recent
advancement in understanding the genetic basis of dilated cardiomyopathy (DCM)
uncovered rare variants in >30 genes attributed to DCM. Each of these genes encodes different types of myocardial
proteins, therefore some also are complicated in other cardiomyopathies,
myopathies, muscular dystrophies, and syndromic diseases. One novel gene identified in 2016 for cardiac-restricted DCM is FLNC.

In this study, we applied a two-step approach of Whole Exome Sequencing (WES)
and bioinformatics tools to a member of an extended non-consanguineous family
affected by DCM. We found a novel splice site
mutation in the FLNC gene (c.2389+1G>A)
cosegregated in all
affected individuals. Using RT-PCR method, we confirmed
that the detected variant leads to abnormal splicing and seems to mediate
pathogenicity due to haploinsufficiency. While a remarkable variable expressivity was
detected among our patients, frequent
arrhythmias followed by a high incidence of sudden cardiac death was found to
be shared between them. In conclusion, we strongly suggest that FLNC
gene should be considered as the
causative pathogenic variant in familial cases with DCM,
specially if accompanied with arrhythmia and high burden of sudden cardiac
death. Timely molecular identification is critical for the carrier detection,
treatment and prevention of progressive heart failure and life-threatening
arrhythmias.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Keywords

Dilated
Cardiomyopathy, Whole Exome Sequencing, FLNC gene, Splicing

 

 

 

 

Introduction

Dilated Cardiomyopathy (DCM) is a
genetically heterogeneous disorder of myocardium characterized by Left Ventricular (LV) chamber enlargement and impaired contractile. The Right Ventricle (RV) may
additionally be enlarged and
dysfunctional 1,2. DCM is a particular clinical condition as the leading worldwide cause for
heart transplantation 3. DCM can arise from either genetic or non-genetic causes. It
seems that about 30% to 50% of DCM cases show familial recurrence (³ 2 affected
in family) and attributable to genetic components 4. The
estimated prevalence of DCM is 1:250. However, this estimate may vary upon the geographic
and ethnic origins as well as the diagnostic criteria 5 and may be gradually increasing over time along
with progressive improvement in systematic clinical screening procedures 4. Numerous genes have been identified for hereditary DCM; each of these
genes encodes a variety of different types of cardiomyocyte proteins, including
sarcomeric, cytoskeletal, calcium channel regulators, transcription factors,
RNA-binding proteins, and others (Table 1) 3,4,6 , however the causative gene underlying the
pathogenesis of ?60% of familial cases with DCM was not identified 3,4. This obvious gap has encouraged ongoing studies to identify more
DCM candidate genes. Recent advances in the
identification of disease–gene associations in DCM categorized at least 47 new
genes for DCM documented in the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk/ac/index.php ) 3. One such novel gene recently
introduced for DCM is FLNC. It is predominantly expressed in striated
muscle where is clearly indicated its fundamental role in association with
myofibrillar myopathies (MFM; MIM#609524) 7. Because of cardiac involvement
features in some of patients with MFM, this gene was included in genetic
screening tests for inherited cardiomyopathies and sudden death since 2012 8. Next-generation sequencing (NGS)
techniques accelerate screening of the cardiomyopathy related genes in
particularly familial cases with the condition 9. In the
current study using Whole Exome sequencing (WES) and bioinformatics-based
analysis a novel splicing variant in FLNC gene (c.2389+1G>A) was
identified in an individual with DCM. The putative FLNC variant segregated with the disease in all symptomatic patients within an
extended Iranian family.

Materials and Methods

 The family is
from Kurdistan province of Iran with a history of familial DCM in at least four
continuous generations. The previously diagnosis of DCM was based on reduced LV
systolic function, and increased LV end-diastolic diameter achieved by
echocardiography, excluding any known cause of myocardial disease 4. The family
decided to identify the underlying pathogenic variant responsible for the
disease in their family immediately after the sudden, unexpected death of their
25-year-old boy. All patients present with isolated
DCM phenotype and there is no evidence of skeletal muscle involvement. A signed
informed consent form was taken from all participants or guardians after being informed of the aim of the research study. This research was approved by the ethics
committee in research of the University of Social Welfare and Rehabilitations
Sciences of Tehran, Iran. Peripheral venous blood of affected and unaffected
individuals of the family was collected in EDTA tubes to continue with
molecular analysis. We classified family members as unaffected if the person was
at least 50 years old without cardiac symptoms or documentation of
echocardiography studies. The remaining family members who already died due to
sudden death event before the age of 65 years old were classified as unknown
clinical status. The proband (IV:14 Fig. 1) is a 49-year-old male presented with the most sever phenotype in the family with the age
of onset 14 years old.

Genomic DNA was extracted using the standard
salting-out method from peripheral blood leukocytes collected in
EDTA-containing tubes. Whole Exome Sequencing was performed for the
patient IV-14. An amount of 50?ng of genomic DNA was used for WES by means of Exome
Enrichment Kit with Agilent’s SureSelect Human All Exon V6 capture
probes on the Illumina HiSeq 4000 platform with the average read depth of 100x
for the targeted platform. Sequence alignment and variant
calling were made against the human reference genome GRCh37/hg19
build and wANNOVAR software (http://wannovar.wglab.org/) was used for variant detection and analysis. Several following steps were taken to
prioritize the entire high-quality variants. Variants in intergenic, down/up
stream, intronic, and UTR regions and synonymous variations were excluded. Based on the hypothesis that the causative mutation for the
disease in family is rare, SNP variations with unreported
Minor Allele Frequency (MAF) or a reported MAF £ 0.01
were considered in the following databases including Exac,
(http://exac.broadinstitute.org/), the 1000 Genomes project
(www.1000genomes.org), and genomAD browser (http://gnomad.broadinstitute.org),
NHLBI Exome Sequencing Project (ESP) (http://evs.gs.washington.edu/EVS/). Moreover, SNP variations observed in an Iranian
control healthy group including 800
healthy Iranian subjects were further excluded. In the next step, we classified the rare
variants according to in silico prediction scores in Polyphen2 (http://genetics.bwh.harvard.edu/pph2/), SIFT (http://sift.bii.astar.edu.sg/),
MutationTaster (www.mutationtaster.org), CADD_phred (cadd.gs.washington.edu/),
and GERP (UCSC Genome Browser). Afterwards, we achieved gene-based
arrangements incorporating conservation scores of the variations using
SiPhy_29way_logOdds score. Taking into account variations that presented in heterozygous state, we finally focused on variants whose genes are involved
in biological pathways related to cardiomyopathies. Screening of the candidate variants were
further followed by sanger sequencing for all family members as the gold
standard for screening and verifying genes of interest.

To evaluate the impact of the FLNC
splice site mutation, total RNA was extracted from peripheral blood mononuclear
cells from an affected individual IV:8 and a healthy individual V:9 using the …
according to manufacturer’s instructions and quantified with a NanoDrop. cDNA was then synthesized
from 100 ng RNA using
the    Kit (Qiagen,). Targeted
sequence spanning exons 14-16 was PCR amplified from the cDNA using cDNA
specific primers as the following. Primers designed for exon/exon junctions of
exon 13-14, and exon 16-17 for forward and reverse primers respectively:
forward: 5 ¢ TGAAGCTCTATGCCCAGGAC 3 ¢, reverse: 5 ¢ GGATCTCCTGGTTGGCAAAC 3 ¢ using NCBI Primer-designing tool
and Primer-BLAST 10 available
online at http://www.ncbi.nlm.nih.gov/tools/primer-blast/. PCR products were resolved using a 2% Agarose gel containing
ethidium bromide and imaged with a         (       CA). PCR condition was preliminary
denaturation at 94 C for 5 min, followed by 20 cycle at 94 C for 30 s, 65 C for 50 s (annealing temperature
decreased 0.5 C per cycle), then 72 C for 1 min, followed by 30 cycles
at 94 C for 30 s, 55 C for 50 s, 72 C for 1 min, ending with a final
extension at 72 C for 10 min.

Results

Upon bioinformatic filtering
strategies 7-candidate variant list prepared to perform confirmation by Sanger
sequencing (Fig. 2 and Table 2). (We have also excluded three Titin (TTN) missense variants
in addition to that 7-candidate variant in table 2). Further cosegregation analysis was followed
using samples from all affected and unaffected subjects to exclude variants
existing in 2 or more unaffected family members. All variants were excluded
except FLNC variant (NM_001458) c.2389+1G>A.

While FLNC c.2389+1G>A variant
was found to be absent from all databases of genomAD
browser, Exac, 1000
Genomes project, ESP, and Iranian
control healthy group it was present in all relatives
with DCM and was missing from definitely unaffected family members (Fig. 3
(a)). Furthermore, we performed cascade genetic screening for the rest of
family members to identify those who are at risk although asymptomatic at the
moment of genetic diagnosis or those with early stage of disease, offering an
opportunity for appropriate intervention.

RT-PCR revealed a single 453-base-pair
fragment spanning exons 14 to 16 in healthy individual V:9 and an extra 329-base-pair
fragment in an affected individual IV:8 (Fig. 3 (b)). Using sanger
sequencing technique this shorter product lacked exon 15 was confirmed. FLNC
mutation at c.2389+1G>A occurs
in a donor splice site at the end of 15th exon that is  predicted to form an aberrant mRNA with an
out of frame deletion of exon 15 (exon skipping) (Fig. 3 (c)). Prediction
was performed using Berkeley Drosophila Genome Project (http://www.fruitfly.org/seq_tools/splice.html), and Human
Splicing Finder (http://www.umd.be/HSF3/) softwares. This aberrant splicing seems to
lead a frameshift and by introducing a stop codon causes premature truncation
of the protein three aminoacids downstream of the mutation site. The aberrantly spliced mRNA transcript from the
mutated allele of FLNC would be expected to be eliminated through
nonsense-mediated mRNA decay (NMD) that likely leading to reduced protein level
and DCM phenotype via a haploinsufficiency model 11.

The phenotypes of all individuals
affected by DCM were cardiac-isolated without serum Creatine Kinase elevation
in at least three DCM affected individuals; indicating no demonstrable skeletal
muscle damage. Based on our knowledge there are at least 17 affected family
members (Fig. 1) 11 living affected individuals participated in our
study (IV:1, IV:8, IV:11, IV:13, IV:14, V:3, V:12, V:13, V:20, V:21, and VI:1)
and six deceased individuals (III:1, III:2, III:7, IV:5, and V:14). The
individuals III:4, and III:5 died of noncardiac causes at the age of 86, and 78
years respectively. The individuals IV:2, IV:3, and IV:4 are definitely
unaffected at the current age of 55, 58, and 75 years old respectively, however
they have not agreed to participate in this study. The individuals III:8, IV:6,
IV:7, IV:9, IV:11, and IV:12 are definitely unaffected at the current age of
84, 80, 60, 52, 58 and, 55 years old respectively who participated in our study
and showed normal genotype for FLNC gene. The individual IV:10 died from
accident at the age of 30 years. The main clinical features of the family members are provided in Table
3 and Fig. 4. The main clinical features of carrier individuals for
c.2389+1G>A FLNC variant are provided in Table 3 and Fig. 4.

The most frequent presentation symptoms among the c.2389+1G>A FLNC carriers
were exertional dyspnea and palpitations. Although the carrier
individuals V:13, and V:15 at the current age of 32, and 39 years old
respectively had evidence of palpitations, shortness of breath, and fatigue,
they have declined further clinical follow-up. Three of the relatives with
positive genotype including the individuals IV:12, V:20, and V:21 at the age of
34, 17, and 5 years old respectively, were asymptomatic at the moment of
diagnosis and diagnosed through family screening. The individual VI:1 is an
11-year-old boy. While he is younger than the typical age of onset, he was also
symptomatic for fatigue, palpitations, dyspnea and cyanosis during sever
physical activities like swimming.

Discussion

     We identified a novel splicing variant in FLNC
gene, cosegregating in an extended family with nonischemic DCM. This pathogenic
variant is not recorded in all queried databases (genomAD browser, Exac, 1000 Genomes project, ESP, and
Iranian control healthy group). FLNC gene encodes filamin C, that is significantly expressed
in cardiac myocytes and involved in
mechanical, sensory, and signal transduction between sarcomeres and sarcolemma 8,12. The protein products of cytoskeletal
genes –such as filamin C- have a critical role in the sarcomere units for
sarcolemmal stability management. Therefore, absence of these genes lead to the
unstable sarcolemma, loss of cardiomyocytes and heart dysfunction 4. Filamin C acts as an actin-cross-linking protein and participates in the actin cytoskeleton reorganization providing mechanical stability for the Z-disc within the sarcomere units 7. It also participates in the attachment of the sarcomere’s Z-disk
to the intercalated disks and to the sarcolemma thereby permitting cell-to-cell
mechanical force transduction (Fig. 5) 8,13.

Fig. 5. Schematic representation of the FLNC
role in mechanical linkages between the contractile apparatus and the
sarcolemma mostly adapted from Gontier et al. 2005 14: FLNC gene contains 48 exons and 47
introns transcribed to filamin C with 2,705-amino acid. The N-terminal of
filamin C protein consists of two calponin homology domains that form the
actin-binding domain (ABD), followed by 24 repeats of nearly 94 amino acids.

Moreover, it contains two hinge sequences prior to repeats 16 and 24 11. Filamin C has been illustrated as a tail-to-tail
associated dimer with the ability to interact with several ligands. The
C-terminal region of filamin C binds to sarcolemma-associated proteins
including both ? and ? sarcoglycans associated with the dystroglycan complex
and cytoplasmic domain of ?1 integrin. It also interacts with Z-disk proteins
such as FATZ-1 (also called calsarcin-2 or myozenin-1), myotilin, myopodin, and
nebulette (only FATZ-1 has been shown). An actin-binding domain in the
N-terminal region of filamin C may be linked with either sarcomeric actin
filaments or cortical actin in the sub-sarcolemmal region, therefore acts as a
connection between actin filaments and costameric sites 8,11,15.

Until recently, FLNC
mutations have only been described in association with MFM and approximately
30% of MFM-affected patients due to FLNC mutations are presented with a
poorly characterized cardiomyopathy 7,8. Remarkably, these patients have history of early sudden death in
their families, however, previous publications did not explain about these
findings in details 8,11. The reported FLNC mutations for MFM are mostly missense
and in frame indels distributed across the gene 8,11,16 and the aggregations of abnormal cytoplasmic filamin C were
confirmed to have a role in the disease pathogenesis 8.  It was only in 2014, that
several missense variants in FLNC gene have been identified in families
with isolated restrictive cardiomyopathy (RCM) and familial isolated hypertrophic
cardiomyopathy (HCM) without skeletal muscle defects symptoms 17,18. Clinical studies in HCM-affected patients indicated the higher
incidence of sudden cardiac death among them 18. The majority of the identified mutations
in these studies were novel and none of them overlapped with the mutations
already reported for MFM 9,18. These findings
show that FLNC pathogenic variants can lead to cardiac muscle defects
without skeletal myopathy and its mutations are not restricted to skeletal
muscle abnormalities 9.

The splicing mutations of FLNC
gene causing isolated DCM was firstl reported in 2016. Begay et al.

identified two novel splicing variants in FLNC gene for three families
with cardiac-restricted DCM phenotype and introduced FLNC as a novel
gene responsible for DCM 7. Afterwards Ortiz-Genga et al. by performing a study on a
large cohort of 2877 individuals with multiple types of inherited cardiac diseases, emphesized on the significant
importance of truncating mutation in FLNC gene on overlapping features
of dilated and arrhythmogenic cardiomyopathies. They also indicated that this
type of FLNC mutations was not observed in patients with other cardiac
phenotypes, such as patients with HCM and skeletal myopathy 8. The current study was performed on
an extended Iranian family with at least 11 affected individuals also highlights
the involvement of FLNC splicing mutation in cardiac-restricted DCM
phenotype. In our
study, as with Ortiz-Genga et al. study,
exertional dyspnea and palpitations were the most frequent symptoms in the
majority of FLNC variant carriers 8 . These symptoms were observed as the primary complications in
our carrier subjects even with an age at onset below 15 years old. Ortiz-Genga et al. indicated that carrier
individuals for truncating mutations in FLNC gene showed variable
degrees of left ventricular dilation and systolic dysfunction, prominent
myocardial left ventricle fibrosis, normal sinus rhythm with inferolateral T
waves inversion, low QRS complex voltages on electrocardiography, and recurrent
ventricular arrhythmias followed by frequent sudden cardiac death with >97%
penetrance in heterozygous carriers older than 40 years old 8 . These finding is also in consistent with our findings
regarding the cardiac phenotype of our patients (Table 3) and also with a highly penetrance
mutation among our carrier. Our data together with Begay et al. and Ortiz-Genga et al. suggested that truncating mutations in FLNC gene is
associated with frequent arrhythmia with high incidence of cardiac sudden death
7,8 . This was independent from remarkable variable expressivity
related to the age of onset and the severity of left ventricular enlargement
and systolic dysfunction in our patients. However, to verifying this
prognostically phenotypic association it is necessary to evaluate it in further
DCM-specific cohorts.

Here, we present growing evidence
that in many cases, aberrant mRNA transcripts contribute to essential
phenotypes associated with transformed cells

The mechanism involved in this type
of mutations is different from that previously described for MFM. This can be
explained by the fact that truncating mutations in FLNC would decrease
the amounts of normal filamin C due to haploinsufficiency 7,8. Reduced level of filamin C protein would influence on the Z-disk
binding potential to sarcolemma and intercalated disks that leads to weakening the attachment of
myocytes. Therefore, the LV myocardium as a muscle exposed to high mechanical force
generation could be predominantly affected. Following this functional
disruption, myocardial fibrosis mainly affecting the LV, along with its
dilation and systolic dysfunction would happen. Finally, the presence of LV
myocardial fibrosis could be associated with ventricular arrhythmia leading to
a high incidence of sudden cardiac death 8. In this regard, there was reported diffuse segmental RV and LV myocardial fibrosis
in one of our patient’s cardiac magnetic resonance, with associated history of
arrhythmic syncope due to ventricular tachycardia.

In conclusion, while a remarkable
variable expressivity was detected among our patients, frequent arrhythmias,
followed by a high incidence of sudden cardiac death was found to be shared
between the affected individuals. Our data together with others who identified FLNC
splicing variants among patients with DCM point to this gene as a
definite cause of DCM due to truncating mutations. The identified variant leads
to aberrant splicing, that seems to trigger the elimination
of the mutant allele transcript through NMD mechanism; which can mediate pathogenicity due to haploinsufficiency. We strongly
suggest that FLNC mutations should be considered as the causative
pathogenic variant in familial cases presenting with dilated cardiomyopathy.

Timely molecular identification is critical for the prediction (carrier
detection), treatment and prevention of progressive heart failure and severe,
life-threatening arrhythmias. For the affected patients with truncating
mutations in FLNC the implantation of a cardiac defibrillator should be
considered.

 

Post Author: admin

x

Hi!
I'm Eunice!

Would you like to get a custom essay? How about receiving a customized one?

Check it out